Cancer Research Technology
Log in Register
Menu

HeLa FRT/TO (YFP-Astrin 4A siRNA res) cell line

Invented by Duccio Conti , Viji M. Draviam
Invented at Queen Mary University of London

Info

Catalogue Number 157864
Parental Line HeLa cell line
Synonyms HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
Host Human
Tissue Cervix
Model Cancer Model
Production Details HeLa FRT/TO YFP-Astrin 4A cell line conditionally expressing siRNA-resistant YFP-Astrin 4A.

Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin 4A expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
Research Area Cell Type or Organelle Marker, Cell Structure and Motility, Cell Signaling & Signal Transduction, Cell Cycle, Cancer
Notes siRNA oligos to target Astrin mRNA 5’ UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU).
Astrin-4A mutant (RVMF to AAAA substitution) was generated using site directed mutagenesis.

References

There are 1 reference entries for this reagent.

View All References

References: 1 entry

31808746


Add a reference

References: 1 entry

31808746


Add a reference

Inventor Information

Inventors

Duccio Conti

Duccio Conti

Viji M. Draviam

Viji M. Draviam

Add an inventor